Monday, April 16, 2012

Binding of Mg2+ and Na+ to RNA, and a new group II intron structure.

Non-specific binding of Na+ and Mg2+ to RNA determined by force spectroscopy methods.
C. V. Bizarro and A. Alemany and F. Ritort
NAR (2012), XX, 1-14

Pulling experiments were done in an RNA hairpin with a stem of 20 base-pairs and a GNRA (GAAA) tetraloop.

Following is the sequence that was annealed and cloned into the pBR322 DNA plasmid:
gcgagccataatctcatct GTTT ccagatgagattatggctcgc

In Tables one and two the authors show results of a persistent length ( P ) determination using the inextensible worm-like chain model where the range of single stranded RNA P, is between 7.5 and 12.7 Angstroms, for Na+ concentrations between 1050mM and 50 mM, and between 7.5 and 12.7 Angstroms, for Mg2+ concentrations between 10mM and 0mM (with fixed [Na+]=50mM).
The results are illustrated in the following graph which is rescaled to illustrate one of the main conclusions of the authors:

"Our findings demonstrate the validity of the approximate rule by which the non-specific binding affinity of divalent cations is equal to that of monovalent cations taken around 100-fold concentration for small molecular constructs"


As one of the final conclusions the authors illustrate in the supplementary material how counterion condensation theory and tightly bound ion (TBI) theory predict the free energies of formation of the RNA hairpin depending on ion concentration for the monovalent and divalent cases, concluding that for the monovalent case counterion condensation theory and TBI are equivalent, but for the divalent case counterion condensation theory fails.



Crystal structure of a group II intron in the pre-catalytic state.
Russell T Chan, Aaron R Robart, Kanagalaghatta R Rajashankar, Anna Marie Pyle and Navtej Toor
NSMB(2012), XX, 1-3

From the same author who got you the very first crystal structure of a group II intron (PDB_ID:3bwp), say, yes! Navtej Toor!, we are getting a second structure from the same intron in a pre-catalytic state, the new structure has a PDB_ID:4ds6, which as of this post hasn't been released yet to the wild. The group II intron is supposed to be an ancestor to the spliceosome and that is one of the reason for it being so interesting. With the previous structure, which was a post-catalytic state structure and this one they propose a full three step structural mechanism for the splicing reaction summarized in the following figure:

No comments:

Post a Comment