Monday, April 16, 2012

Binding of Mg2+ and Na+ to RNA, and a new group II intron structure.

Non-specific binding of Na+ and Mg2+ to RNA determined by force spectroscopy methods.
C. V. Bizarro and A. Alemany and F. Ritort
NAR (2012), XX, 1-14

Pulling experiments were done in an RNA hairpin with a stem of 20 base-pairs and a GNRA (GAAA) tetraloop.

Following is the sequence that was annealed and cloned into the pBR322 DNA plasmid:
gcgagccataatctcatct GTTT ccagatgagattatggctcgc

In Tables one and two the authors show results of a persistent length ( P ) determination using the inextensible worm-like chain model where the range of single stranded RNA P, is between 7.5 and 12.7 Angstroms, for Na+ concentrations between 1050mM and 50 mM, and between 7.5 and 12.7 Angstroms, for Mg2+ concentrations between 10mM and 0mM (with fixed [Na+]=50mM).
The results are illustrated in the following graph which is rescaled to illustrate one of the main conclusions of the authors:

"Our findings demonstrate the validity of the approximate rule by which the non-specific binding affinity of divalent cations is equal to that of monovalent cations taken around 100-fold concentration for small molecular constructs"


As one of the final conclusions the authors illustrate in the supplementary material how counterion condensation theory and tightly bound ion (TBI) theory predict the free energies of formation of the RNA hairpin depending on ion concentration for the monovalent and divalent cases, concluding that for the monovalent case counterion condensation theory and TBI are equivalent, but for the divalent case counterion condensation theory fails.



Crystal structure of a group II intron in the pre-catalytic state.
Russell T Chan, Aaron R Robart, Kanagalaghatta R Rajashankar, Anna Marie Pyle and Navtej Toor
NSMB(2012), XX, 1-3

From the same author who got you the very first crystal structure of a group II intron (PDB_ID:3bwp), say, yes! Navtej Toor!, we are getting a second structure from the same intron in a pre-catalytic state, the new structure has a PDB_ID:4ds6, which as of this post hasn't been released yet to the wild. The group II intron is supposed to be an ancestor to the spliceosome and that is one of the reason for it being so interesting. With the previous structure, which was a post-catalytic state structure and this one they propose a full three step structural mechanism for the splicing reaction summarized in the following figure:

Friday, April 13, 2012

April 2012 Review

The structure of triplex DNA in the gas phase.
Arcella A, Portella G, Ruiz ML, Eritja R, Vilaseca M, Gabelica V, Orozco M.
JACS (2012), XX, 1-28


Discrete RNA libraries from pseudo-torsional space.
Humphris-Narayanan E, Pyle AM.
JMB (2012), Mar13

This seems to be an update on using virtual bonds as ramachandran criteria for structure simplification. Again, no mention whatsoever of Wilma's work.


Thursday, April 5, 2012

Catching up on RNA News.

The last post in this blog happened in January and it shied away from the meaty content of RNA.
This is my attempt to catch up, and hopefully to produce at least a brief reminder of RNA related news, mainly for personal use, sorry if this comes out too cryptic for the general public.


Very nicely sold article from the abstract description. It still is to be seen how this new parametrization of fixed charges to dielectric constants works as compared to the traditional TIP3 and SPC, time will tell.
Fennell CJ, Li L, Dill KA.
J Phys Chem B. 2012 Mar 7. [Epub ahead of print]
PMID: 22397577 [PubMed - as supplied by publisher]


Four low-resolution structure determination techniques are evaluated in combination with the MC-SYM MC-FOLD pipeline. The techniques are hydroxyl radical footprinting (OH), methidiumpropyl-EDTA (MPE), multiplexed hydroxyl radical cleavage (MOHCA), and small-angle X-ray scattering (SAXS). There are two sets of interactions proposed to compare the predicted vs. the experimental structures named low and high. The high includes tertiary interactions. As I understand it the experimental data is fit to the MC-SYM MC-FOLD pipeline results to find the best fit between them.
Parisien M, Major F.
J Struct Biol. 2012 Feb 23. [Epub ahead of print]
PMID: 22387042 [PubMed - as supplied by publisher]


These guys sound like physicists using jargon. In this case they are using the Rosetta software to bridge protein structure prediction and RNA loop models, nothing new, but they seem like a powerful group.
Sripakdeevong P, Kladwang W, Das R.
Proc Natl Acad Sci U S A. 2011 Dec 20;108(51):20573-8. Epub 2011 Dec 5.
PMID: 22143768 [PubMed - indexed for MEDLINE]


For me it was interesting to see someone combining OPLS and AMBER (old, not the newish Orozco params for nucleic acids), using a molecular dynamics program I didn't know about called MOIL (from a group in U. Texas@Austin headed by a Ron Elber).
It was also surprising to see a non-referenced value for the persistence length of dsRNA as being about 500 base-pairs, that is, > 1500 Angstroms, not even close to the old Hagerman experimental values (around 700 Angstrom), being used as justification for keeping their ARNA's frozen in the simulation, makes you wonder what will happen if they're not kept "frozen". Later I noticed that this was an error and they meant 500 Angstrom, which still is not right, but at least that's the DNA persistence length.
It is interesting also how they sort of compare their results for the radial distribution functions against counterion condensation theory.
The Ionic Atmosphere around A-RNA: Poisson-Boltzmann and Molecular Dynamics Simulations
Serdal Kirmizialtin, Alexander R.J. Silalahi, Ron Elber†, Marcia O. Fenley
Biophysical Journal
Volume 102, Issue 4, 22 February 2012, Pages 829–838
http://www.sciencedirect.com/science/article/pii/S0006349512000628

RNA and Its Ionic Cloud: Solution Scattering Experiments and Atomically Detailed Simulations
Serdal Kirmizialtin, Suzette A. Pabit, Steve P. Meisburger, Lois Pollack, Ron Elber
Biophysical Journal
Volume 102, Issue 4, 22 February 2012, Pages 819–828
http://www.sciencedirect.com/science/article/pii/S0006349512000860